National Center for Biotechnology Information
Where scientists search the language of life
This is an interactive helper. Select a real-world research mission below to learn exactly how and where to search on the actual NCBI website:
Select a Search Mission:
Mission 1: Check a Patient's Mutation
How do I find out if a clinical gene variant is pathogenic or benign?
Mission 2: Align an Unknown DNA Sequence
I have a raw FASTA sequence string. How do I use BLAST to find its origin?
Literature
Literature & Taxonomy
Over 36 million biomedical citations and the tree of life.
Database Distinctions
PubMed (Index Only) Large citation index — 36M+ abstracts. Links to publisher sites. No guarantee of free full text.
PMC (Full Text Archive) Completely free, open-access full text of millions of journal articles. Mandated by NIH.
PubMed Abstract View (PMID: 3421182)
Genomic landscapes of hereditary breast cancers...
Abstract: Variants inside the regulatory domains of BRCA1 transcripts directly correlated with structural pathogenetic destabilization shifts...
MeSH: Breast NeoplasmsMeSH: Female
Clinical
ClinVar & Genetics
Connecting human genomic variations to health and disease.
Variant Classifications
Pathogenic / Likely Pathogenic Strong evidence the variant causes disease. Used in clinical diagnostics.
VUS (Variant of Uncertain Significance) Insufficient evidence to classify. Common bottleneck in clinical genomics.
| Variant ID | Interpretation | Review Status |
|---|---|---|
| rs121912488 | Pathogenic | ⭐⭐⭐⭐ (expert panel) |
Genomics
Genomes & GenBank
Comprehensive DNA/RNA sequence repositories.
Core Databases
GenBank (Archival) Open-access — anyone can submit sequences. Accepts raw, unverified submissions.
RefSeq (Curated) NCBI-curated, non-redundant reference sequences. Gold standard for annotation.
>NC_000001.11 Homo sapiens chromosome 1
GATCAATGAGGTGGACACCAGAGGTAAGGGGGTTCTAAT
ACCAGAGGTAAGGGGGTTCTAAATTTTAAACCGGTTTAA
Structure
Protein Structures
Amino acid sequences, domains, and 3D modeling.
Structural Databases
PDB Integration Links directly to the Protein Data Bank for experimentally-determined 3D folding structures.
CDD (Conserved Domain) Identifies functional protein domains using scoring matrices.
Conserved Domain Architecture Return
Isolated Hits: BRCT Functional Repeat Superfamily
Big Data
Sequence Read Archive
The largest public repository of raw NGS sequencing data.
Next-Gen Sequencing
Raw Reads (FASTQ) Stores unaligned trace files from Illumina, PacBio, or Nanopore pipelines. Includes ASCII base quality rows.
@SRR001234.1 run_1 length=12
GATTACAATGGC
+
C9F::EEEHI99
GATTACAATGGC
+
C9F::EEEHI99
Alignment
BLAST Tool
Basic Local Alignment Search Tool logic & metrics.
Alignment
Scoring & Metrics
E-Value (Expect Value) Chance background noise frequency score. Target threshold should ideally sit under 0.001.
Query_1 1 ATCGGCTAA 9
|||||||||
Sbjct_1 40 ATCGGCTAA 48
|||||||||
Sbjct_1 40 ATCGGCTAA 48
Application: Connecting the Nodes
The Genetic Disease Workflow
How researchers traverse the NCBI network to solve a clinical case. Hover each step for details.
Step 01
PubMed
Query literature for symptoms.
PubMed Search Use MeSH terms + symptom keywords. Filter by review articles to get an overview of known genetic causes for the phenotype.
Step 02
ClinVar
Identify pathogenic variants.
ClinVar Lookup Search the candidate gene. Filter by "Pathogenic" or "Likely Pathogenic." Cross-reference with patient's variant from sequencing data.
Step 03
GenBank
Pull the reference DNA.
Fetch RefSeq Download the canonical mRNA transcript (NM_*) or chromosome region (NC_*) as FASTA for local comparison and annotation.
Step 04
Proteins
Analyze broken 3D structures.
Structure Analysis Use PDB viewer to inspect wild-type vs mutant protein folding. CDD reveals if variant disrupts a conserved functional domain.
Step 05
BLAST
Align sequence to find origins.
blastp / blastn Run the mutant protein against nr database. Low E-value hits confirm the affected domain is conserved across species — supporting pathogenicity.
Live Alignment Demo
Sequence Alignment Visualizer
Press "Run Align" to begin the simulated BLAST alignment →
Max Identity Score
—
E-Value Confidence
—